anti ccne2 (Cell Signaling Technology Inc)
Cell Signaling Technology Inc is a verified supplier 
Cell Signaling Technology Inc manufactures this product 
96
Structured Review
Cell Signaling Technology Inc
anti ccne2
Anti Ccne2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 361 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+ccne2/Cyclin+E2+Antibody/pm41157796-64-35-38
Average 96 stars, based on 361 article reviews
Anti Ccne2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 361 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+ccne2/Cyclin+E2+Antibody/pm41157796-64-35-38
Average 96 stars, based on 361 article reviews
anti ccne2 - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Western Blot:Article Title: Sevoflurane impairs learning and memory of the developing brain through post-transcriptional inhibition of CCNA2 via microRNA-19-3p Article Snippet: The cells or rat brain tissue were homogenized in protein lysis buffer to obtain protein, the concentration of which was determined using a BCA protein assay kit (Bio-rad, Beijing, China). .. Western blot was done as routine, using primary antibodies including rabbit anti-BDNF, anti-CCNA1, anti-CCNA2, anti-CCNB1, anti-CCNE1, SDS Page:Article Title: MiR-30a-5p Regulates the Proliferation of Wilms Tumor Cells Through CyclinE2. Article Snippet: The relative expression level was determined using the 2−ΔΔCq method. miR- 30a- 5p upstream primer: 5′- TCTGTAAACATCCTCGACTGGAAG- 3′; miR- 30a- 3p upstream primer: 5′- CTTTCAGTCGGATGTTTGCAGC- 3′; miR200a- 3p upstream primer: 5′- CGCTAACACTGTCTGGTAACG ATGT- 3′; the downstream primers of miR- 30a- 5p, miR- 30a- 3p and miR- 200a- 3p: the Universal downstream primers (B661601; Sangon Biotech, Shanghai, China); CCNE2 upstream primer: 5′- GGAACCACAGATGAGGTCCAT- 3′, downstream primer: 5′- CCATCAGTGACGTAAGCAAACT- 3′; GAPDH upstream primer: 5′- ACAGTCAGCCGCATCTTCT- 3′, downstream primer: 5′- GACAAGCTTCCCGTTCTCAG- 3′; U6 upstream primer: 5′- CTCGCTTCGGCAGCACA- 3′, downstream primer: 5′- AACGCTTCACGAATTTGCGT- 3′. .. The total protein was separated on 10% SDS- PAGE, moved to NC membrane, and then sealed with 5% non- fat milk or 5% bovine serum albumin (for sealing p- Rb protein) followed by incubation with Membrane:Article Title: MiR-30a-5p Regulates the Proliferation of Wilms Tumor Cells Through CyclinE2. Article Snippet: The relative expression level was determined using the 2−ΔΔCq method. miR- 30a- 5p upstream primer: 5′- TCTGTAAACATCCTCGACTGGAAG- 3′; miR- 30a- 3p upstream primer: 5′- CTTTCAGTCGGATGTTTGCAGC- 3′; miR200a- 3p upstream primer: 5′- CGCTAACACTGTCTGGTAACG ATGT- 3′; the downstream primers of miR- 30a- 5p, miR- 30a- 3p and miR- 200a- 3p: the Universal downstream primers (B661601; Sangon Biotech, Shanghai, China); CCNE2 upstream primer: 5′- GGAACCACAGATGAGGTCCAT- 3′, downstream primer: 5′- CCATCAGTGACGTAAGCAAACT- 3′; GAPDH upstream primer: 5′- ACAGTCAGCCGCATCTTCT- 3′, downstream primer: 5′- GACAAGCTTCCCGTTCTCAG- 3′; U6 upstream primer: 5′- CTCGCTTCGGCAGCACA- 3′, downstream primer: 5′- AACGCTTCACGAATTTGCGT- 3′. .. The total protein was separated on 10% SDS- PAGE, moved to NC membrane, and then sealed with 5% non- fat milk or 5% bovine serum albumin (for sealing p- Rb protein) followed by incubation with Incubation:Article Title: MiR-30a-5p Regulates the Proliferation of Wilms Tumor Cells Through CyclinE2. Article Snippet: The relative expression level was determined using the 2−ΔΔCq method. miR- 30a- 5p upstream primer: 5′- TCTGTAAACATCCTCGACTGGAAG- 3′; miR- 30a- 3p upstream primer: 5′- CTTTCAGTCGGATGTTTGCAGC- 3′; miR200a- 3p upstream primer: 5′- CGCTAACACTGTCTGGTAACG ATGT- 3′; the downstream primers of miR- 30a- 5p, miR- 30a- 3p and miR- 200a- 3p: the Universal downstream primers (B661601; Sangon Biotech, Shanghai, China); CCNE2 upstream primer: 5′- GGAACCACAGATGAGGTCCAT- 3′, downstream primer: 5′- CCATCAGTGACGTAAGCAAACT- 3′; GAPDH upstream primer: 5′- ACAGTCAGCCGCATCTTCT- 3′, downstream primer: 5′- GACAAGCTTCCCGTTCTCAG- 3′; U6 upstream primer: 5′- CTCGCTTCGGCAGCACA- 3′, downstream primer: 5′- AACGCTTCACGAATTTGCGT- 3′. .. The total protein was separated on 10% SDS- PAGE, moved to NC membrane, and then sealed with 5% non- fat milk or 5% bovine serum albumin (for sealing p- Rb protein) followed by incubation with Produced:Article Title: Regnase-2 inhibits glioblastoma cell proliferation Article Snippet: .. The following antibodies were used: anti-CCNE1 (#4129, Cell Signaling Technology), |